Photos / Sounds

Observer

dianerhunt

Date

May 31, 2022 11:01 AM AKDT
Anthaxia - Photo (c) gbohne, some rights reserved (CC BY-SA)
danabrennan's ID: Genus Anthaxia, a member of Metallic Wood-boring Beetles (Family Buprestidae)
Added on June 07, 2022
Improving

Photos / Sounds

Observer

kmaher

Date

June 4, 2022 03:45 PM AKDT
Dicerca - Photo (c) Scott King, some rights reserved (CC BY-NC)
danabrennan's ID: Genus Dicerca, a member of Metallic Wood-boring Beetles (Family Buprestidae)
Added on June 06, 2022
Supporting

Photos / Sounds

What

Aspen Serpentine Leafminer Moth (Phyllocnistis populiella)

Observer

akr

Date

June 4, 2022 11:45 AM AKDT
Aspen Serpentine Leafminer Moth - Photo (c) Alan Vernon, some rights reserved (CC BY-NC-SA)
danabrennan's ID: Aspen Serpentine Leafminer Moth (Phyllocnistis populiella)
Added on June 06, 2022
Supporting

Photos / Sounds

What

Tall Bluebell (Mertensia paniculata)

Date

June 5, 2022 03:50 PM AKDT
Tall Bluebell - Photo (c) Susan Elliott, some rights reserved (CC BY-NC), uploaded by Susan Elliott
danabrennan's ID: Tall Bluebell (Mertensia paniculata)
Added on June 06, 2022
Supporting

Photos / Sounds

Observer

robertweeden

Date

June 19, 2021 04:02 PM AKDT

Description

4.5 mm

Definite and distinctive black spots on the wings. White knees.Yellow markings on head. Found while splitting wood in mostly balsam poplar forest clearing.

Heterarthrus nemoratus - Photo (c) Dana Brennan, some rights reserved (CC BY-NC), uploaded by Dana Brennan
danabrennan's ID: Heterarthrus nemoratus, a member of Common Sawflies (Family Tenthredinidae)
Added on June 05, 2022
Supporting

Photos / Sounds

Observer

robertweeden

Date

April 22, 2022 05:04 PM AKDT
Glischrochilus vittatus - Photo (c) Stuart Tingley, some rights reserved (CC BY-NC), uploaded by Stuart Tingley
danabrennan's ID: Glischrochilus vittatus, a member of Sap-feeding Beetles (Family Nitidulidae)
Added on June 05, 2022
Supporting

Photos / Sounds

What

Birch Shield Bug (Elasmostethus interstinctus)

Observer

bit

Date

May 27, 2022 07:12 PM AKDT
Birch Shield Bug - Photo (c) Bryan Smith, some rights reserved (CC BY-NC), uploaded by Bryan Smith
danabrennan's ID: Birch Shield Bug (Elasmostethus interstinctus)
Added on June 05, 2022
Supporting

Photos / Sounds

What

Tall Bluebell (Mertensia paniculata)

Observer

kittietrubelle

Date

May 29, 2022 08:36 PM AKDT
Tall Bluebell - Photo (c) Susan Elliott, some rights reserved (CC BY-NC), uploaded by Susan Elliott
danabrennan's ID: Tall Bluebell (Mertensia paniculata)
Added on June 05, 2022
Supporting

Photos / Sounds

What

Prickly Wild Rose (Rosa acicularis)

Observer

kdog907

Date

June 2, 2022 07:38 AM AKDT
Prickly Wild Rose - Photo (c) sydcannings, some rights reserved (CC BY-NC), uploaded by sydcannings
danabrennan's ID: Prickly Wild Rose (Rosa acicularis)
Added on June 05, 2022
Supporting

Photos / Sounds

What

Prickly Wild Rose (Rosa acicularis)

Observer

abbydaniel75

Date

June 5, 2022 01:42 PM AKDT
Prickly Wild Rose - Photo (c) sydcannings, some rights reserved (CC BY-NC), uploaded by sydcannings
danabrennan's ID: Prickly Wild Rose (Rosa acicularis)
Added on June 05, 2022
Improving

Photos / Sounds

What

Human (Homo sapiens)

Observer

ansonjovi

Date

April 17, 2022 04:46 PM HKT
Human - Photo no rights reserved, uploaded by Abhas Misraraj
danabrennan's ID: Human (Homo sapiens)
Added on May 28, 2022
Supporting

Photos / Sounds

What

2-spot Ladybird (Adalia bipunctata)

Observer

awenninger

Date

May 24, 2022 06:49 PM AKDT
Two-spotted Lady Beetle - Photo (c) Lupoli Roland, some rights reserved (CC BY-NC), uploaded by Lupoli Roland
danabrennan's ID: 2-spot Ladybird (Adalia bipunctata)
Added on May 25, 2022
Supporting

Photos / Sounds

What

Plant Bugs (Family Miridae)

Observer

akr

Date

May 16, 2020 11:18 AM AKDT
Lygus Bugs - Photo (c) WonGun Kim, all rights reserved, uploaded by WonGun Kim
danabrennan's ID: Lygus Bugs (Genus Lygus)
Added on April 04, 2022
Leading

Photos / Sounds

Observer

awenninger

Date

August 5, 2020 03:41 PM AKDT

Description

Host is balsam poplar .LifeScanner returned Phyllocolpa excavata as ID. BOLD-C48, DNA barcode: COI-5P
AACATTATATTTTATTTTAGGATTTTGATCAGGAATACTAGGATTATCATTTAGAATATTAATCCGAACAGAATTAGGAATACCCGGATCAATAATTGGAGATGATCAAATTTATAATGTAATTGTAACATCTCATGCATTTTTAATAATTTTCTTCATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATAGCATTTCCCCGACTAAATAATATAAGATTTTGATTTCTACCACCTTCATTAATTTTATTATTATCTAGAAGAATAGTAAATTCAGGATCAGGAACTGGATGAACTGTATACCCACCTTTATCAAGAAGAATCTCCCATTCAGGAGCATCAGTAGATTTAACTATTTTTTCTTTACATTTAGCAGGAATTTCATCAATCCTGGGAGCAATTAATTTTATTTCAACAATAATTAATATAAAATTAAAAGGAATAAAATTTGAACAAATACCTTTATTTGTATGAGCAGTATCATTAACTGCACTATTATTACTTCTATCATTACCCGTATTAGCAGGAGCTATTACTATACTTCTCACAGATCGTAACTTAAATACATCTTTTTTTG-

Euura megacephala - Photo (c) Alex (Alexandria) Wenninger, some rights reserved (CC BY-NC), uploaded by Alex (Alexandria) Wenninger
danabrennan's ID: Euura megacephala, a member of Common Sawflies (Family Tenthredinidae)
Added on February 03, 2022
Supporting
Added as part of a taxon swap

Photos / Sounds

What

Yellowheaded Spruce Sawfly (Euura alaskensis)

Observer

awenninger

Date

July 8, 2020 08:56 AM AKDT

Description

On Colorado blue spruce

Yellowheaded Spruce Sawfly - Photo (c) Eric Knopf, some rights reserved (CC BY-NC), uploaded by Eric Knopf
danabrennan's ID: Yellowheaded Spruce Sawfly (Euura alaskensis)
Added on February 02, 2022
Supporting
Added as part of a taxon swap

Photos / Sounds

Observer

hubertszcz

Date

June 19, 2021 07:58 AM CST
Euura - Photo (c) Felix Riegel, some rights reserved (CC BY-NC), uploaded by Felix Riegel
danabrennan's ID: Genus Euura, a member of Common Sawflies (Family Tenthredinidae)
Added on February 02, 2022
Supporting
Added as part of a taxon swap

Photos / Sounds

What

Gooseberry Sawfly (Euura ribesii)

Observer

connietaylor

Date

July 7, 2020 02:08 PM AKDT

Description

Imported Currantworm - Photo (c) Connie Taylor, some rights reserved (CC BY), uploaded by Connie Taylor
danabrennan's ID: Gooseberry Sawfly (Euura ribesii)
Added on February 01, 2022
Supporting
Added as part of a taxon swap

Photos / Sounds

What

Gooseberry Sawfly (Euura ribesii)

Observer

connietaylor

Date

June 23, 2020 02:39 PM AKDT
Imported Currantworm - Photo (c) Connie Taylor, some rights reserved (CC BY), uploaded by Connie Taylor
danabrennan's ID: Gooseberry Sawfly (Euura ribesii)
Added on February 01, 2022
Improving
Added as part of a taxon swap

Photos / Sounds

Observer

awenninger

Date

June 10, 2020 01:23 PM AKDT
Propelling Click Beetle - Photo (c) pierrickb, some rights reserved (CC BY-NC), uploaded by pierrickb
danabrennan's ID: Propelling Click Beetle (Stropenron propola)
Added on December 16, 2021
Leading
Added as part of a taxon swap

Photos / Sounds

What

Waterlily Leaf Beetle (Galerucella nymphaeae)

Observer

jason5

Date

July 9, 2019 08:51 AM AKDT

Description

Eats lily pads, flies with hind legs on water, and walks on water. Found in lake/bog. Looks related to willow leaf beetles

Waterlily Leaf Beetle - Photo (c) Marie Lou Legrand, some rights reserved (CC BY-NC), uploaded by Marie Lou Legrand
danabrennan's ID: Waterlily Leaf Beetle (Galerucella nymphaeae)
Added on December 02, 2021
Supporting

Photos / Sounds

What

Beetles (Order Coleoptera)

Observer

sitkaconnor

Date

May 10, 2020 06:02 AM AKDT
Hylastini - Photo (c) Kevin Daniel Chase, some rights reserved (CC BY-NC), uploaded by Kevin Daniel Chase
danabrennan's ID: Tribe Hylastini, a member of Bark and Ambrosia Beetles (Subfamily Scolytinae)
Added on October 16, 2021
Leading
Added as part of a taxon swap

Photos / Sounds

Observer

robertweeden

Date

August 22, 2020 11:34 PM AKDT

Description

Atrracted to 100 W black light set up along a ski trail in black spruce forest.

Thanks to V. Belov for identification - https://bugguide.net/node/view/1880406

Chilothorax distinctus - Photo (c) Ivan Pancic, some rights reserved (CC BY-NC), uploaded by Ivan Pancic
danabrennan's ID: Chilothorax distinctus, a member of Small Dung Beetles (Subfamily Aphodiinae)
Added on October 06, 2021
Leading
Added as part of a taxon swap

Photos / Sounds

What

Minute Brown Scavenger Beetles (Family Latridiidae)

Observer

laurenyancy

Date

August 27, 2021 11:26 AM AKDT
Minute Brown Scavenger Beetles - Photo (c) Mike Quinn, Austin, TX, some rights reserved (CC BY-NC), uploaded by Mike Quinn, Austin, TX
danabrennan's ID: Minute Brown Scavenger Beetles (Family Latridiidae)
Added on September 03, 2021
Leading

Photos / Sounds

What

Vapourer Moth (Orgyia antiqua)

Observer

iceranger907

Date

August 29, 2021 04:43 PM AKDT
Rusty Tussock Moth - Photo (c) Dick, some rights reserved (CC BY-NC-SA)
danabrennan's ID: Vapourer Moth (Orgyia antiqua)
Added on September 03, 2021
Supporting

Photos / Sounds

What

Birch Shield Bug (Elasmostethus interstinctus)

Observer

eagilch

Date

August 31, 2021 10:17 AM AKDT
Birch Shield Bug - Photo (c) Bryan Smith, some rights reserved (CC BY-NC), uploaded by Bryan Smith
danabrennan's ID: Birch Shield Bug (Elasmostethus interstinctus)
Added on September 03, 2021
Supporting

Photos / Sounds

What

North American Elm Sawfly (Cimbex americanus)

Observer

tessa_dennis

Date

September 2, 2021 06:02 PM AKDT
North American Elm Sawfly - Photo (c) Danny Barron, some rights reserved (CC BY-NC-ND)
danabrennan's ID: North American Elm Sawfly (Cimbex americanus)
Added on September 03, 2021
Supporting

Photos / Sounds

What

Battered Sallow (Sunira verberata)

Observer

awenninger

Date

July 1, 2020 11:08 AM AKDT

Description

On ground in mixed aspen stand, some willow and other woody shrubs

DNA barcode by LifeScanner: COI-5P
TTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGACTTGTTCCCCTAATGTTAGGGGCTCCTGATATAGCATTCCCTCGATTAAATAATATAAGTTTCTGATTATTGCCCCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTATACCCCCCTCTTTCATCTAATATTGCCCATGGTGGAAGATCTGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAGTTTATCTTTTGATCAAATACCTCTATTTATTTGAGCTGTAGGAATTACAGCATTCCTACTATTATTATCACTGCCTGTTTTAGCTGGGGCTATTACCATATTATTAACAGATCGAAATTTAAATACATCTTTTTTT-----------------------------------------------------------------------------------------------------------------

Battered Sallow - Photo (c) M. Goff, some rights reserved (CC BY-NC-SA), uploaded by M. Goff
danabrennan's ID: Battered Sallow (Sunira verberata)
Added on August 18, 2021
Supporting

Photos / Sounds

What

Aspen Leaf Blotch Miner (Phyllonorycter apparella)

Observer

awenninger

Date

August 29, 2018 09:14 PM AKDT

Description

Barcode from LifeScanner: COI-5P
AACTCTTTATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGATCTTCTTTAAGAATTATAATTCGAGCAGAATTAGGAAATCCCGGATCTTTAATTGGGGACGATCAAATTTATAATACAATTGTAACCGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTTCCTTTAATATTAGGAGCACCTGATATGGCTTTCCCACGACTTAATAATATAAGATTTTGATTATTACCACCTTCTATCTTACTTTTAATTTCAAGAAGAATTGTTGAAAATGGGGCTGGAACAGGATGAACTGTTTATCCACCATTATCCTCTAATGTAGCTCATGGGGGCAGATCTGTAGATTTAGCAATTTTCTCTTTACACTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATCATTAATATACGAGCTAATGGAATAATATTTGATAATATACCCTTATTTGTTTGAGCTGTAGGTATTACAGCTTTACTTCTTCTATTATCATTACCTGTATTAGCGGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCAGCNGGAGGAGGAG

Aspen Leaf Blotch Miner - Photo (c) David Beadle, all rights reserved, uploaded by dbeadle
danabrennan's ID: Aspen Leaf Blotch Miner (Phyllonorycter apparella)
Added on August 18, 2021
Supporting

Photos / Sounds

Observer

awenninger

Date

August 15, 2021 02:21 PM AKDT
Hippodamia quinquesignata quinquesignata - Photo (c) Scott Gilmore, some rights reserved (CC BY-NC), uploaded by Scott Gilmore
danabrennan's ID: Hippodamia quinquesignata ssp. quinquesignata, a member of American Five-spotted Lady Beetle (Hippodamia quinquesignata)
Added on August 18, 2021
Supporting

Photos / Sounds

What

Scarabs (Family Scarabaeidae)

Observer

muir

Date

July 19, 2021 09:02 AM AKDT

Description

Dead beetle, noticed in the folds of raingear. I'm locating the observation on the map where I found it, and it is possible/likely that the live beetle was first encountered here because the raingear was last used at the same location, one year ago. However, the possibility exists that the beetle found its way into the raingear in Anchorage and its body was transported down to Kenai.

Small Dung Beetles - Photo (c) Mike Quinn, Austin, TX, some rights reserved (CC BY-NC), uploaded by Mike Quinn, Austin, TX
danabrennan's ID: Small Dung Beetles (Subfamily Aphodiinae)
Added on August 17, 2021
Leading

Stats

  • 446