Photos / Sounds

What

Scarabs (Family Scarabaeidae)

Observer

kameierotto

Date

June 19, 2022 12:55 PM CDT

Photos / Sounds

Observer

awenninger

Date

August 5, 2020 03:41 PM AKDT

Description

Host is balsam poplar .LifeScanner returned Phyllocolpa excavata as ID. BOLD-C48, DNA barcode: COI-5P
AACATTATATTTTATTTTAGGATTTTGATCAGGAATACTAGGATTATCATTTAGAATATTAATCCGAACAGAATTAGGAATACCCGGATCAATAATTGGAGATGATCAAATTTATAATGTAATTGTAACATCTCATGCATTTTTAATAATTTTCTTCATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCCCCTGATATAGCATTTCCCCGACTAAATAATATAAGATTTTGATTTCTACCACCTTCATTAATTTTATTATTATCTAGAAGAATAGTAAATTCAGGATCAGGAACTGGATGAACTGTATACCCACCTTTATCAAGAAGAATCTCCCATTCAGGAGCATCAGTAGATTTAACTATTTTTTCTTTACATTTAGCAGGAATTTCATCAATCCTGGGAGCAATTAATTTTATTTCAACAATAATTAATATAAAATTAAAAGGAATAAAATTTGAACAAATACCTTTATTTGTATGAGCAGTATCATTAACTGCACTATTATTACTTCTATCATTACCCGTATTAGCAGGAGCTATTACTATACTTCTCACAGATCGTAACTTAAATACATCTTTTTTTG-

Photos / Sounds

Observer

earljohnson

Date

July 16, 2020

Photos / Sounds

Observer

gwark

Date

June 2, 2020 12:00 AM AKDT

Photos / Sounds

Observer

machi

Date

July 22, 2017 05:55 PM EDT