Photos / Sounds

What

Fruiting Honeycomb Lichen (Hypogymnia lophyrea)

Observer

damontighe

Date

November 17, 2018 10:13 AM PST

Photos / Sounds

What

Powdered Honeycomb Lichen (Hypogymnia hultenii)

Observer

kueda

Date

November 13, 2016 11:13 AM PST

Description

Note the soredia on top and the pitted lower surface.

Photos / Sounds

Observer

gwark

Date

March 15, 2024 10:24 PM AKDT

Photos / Sounds

What

Western Spotted Coralroot (Corallorhiza maculata var. occidentalis)

Observer

shanebustapbj

Date

June 13, 2021 04:43 PM PDT

Description

Peloric form

Photos / Sounds

What

Broomleaf Toadflax (Linaria genistifolia)

Observer

carnifex

Date

September 22, 2017 03:36 PM CEST

Description

'Peloria'-mutant with actinomorphic flowers instead of zygomorphic

Photos / Sounds

What

Oriental Tortellini Snail (Philine orientalis)

Observer

amorganjr

Date

September 1, 2018 12:16 PM PDT

Photos / Sounds

What

Volcano Sponge (Anoxycalyx joubini)

Observer

umihoshijima

Date

October 17, 2016 09:09 AM PDT

Description

Depth of ~115 feet, Sponge is <2m tall. Seasonal solid ice cover (>2m thick). Water temp -1.7˚C, salinity 35ppt.

Photos / Sounds

What

Docks and Sorrels (Genus Rumex)

Observer

okbirdman

Date

April 8, 2023 12:25 PM PDT

Photos / Sounds

What

Citrus Green Mold (Penicillium digitatum)

Observer

keith_seifert

Date

December 11, 2020 12:52 PM EST

Description

On a clementine orange.

This in interesting because both the common Penicillium species on oranges are in this image. The faster growing, paler green one covering most of the fruit is P. digitatum. The powdery, more blue colony at the top of the fruit is P. italicum.

Photos / Sounds

What

Tissue Moth (Triphosa haesitata)

Observer

okbirdman

Date

February 3, 2024 03:23 PM PST

Description

Several large groups wintering in a hollowed redwood, as is common for this species (see here). Very cool to see such a wide range of variability among these individuals!

Photos / Sounds

Observer

okbirdman

Date

November 8, 2023 04:54 PM PST

Description

On Salvia guaranitica (anise-scented sage)

Photos / Sounds

Observer

chloe_and_trevor

Date

December 5, 2020 12:16 PM PST

Description

Found under the bark of an oak, feeding on white fungus. Covered in mites, presumably hitching a ride, reminiscent of Silphidae mites. 4mm long. Male and female show dimorphic antennae, which is cool.

Photos / Sounds

What

Banana Slugs (Genus Ariolimax)

Observer

kueda

Date

November 9, 2017 11:50 AM PST

Photos / Sounds

What

Acoelomorph Flatworms (Subphylum Acoelomorpha)

Observer

anudibranchmom

Date

November 26, 2022 12:27 AM PST

Description

Or not? The small, black-headed worm in front of the nudibranch. Could easily be an introduced species @leslieh

Photos / Sounds

Observer

avutardafuriosa

Date

March 5, 2021 04:01 PM -03

Description

El alambre mide 1,2 mm.

Photos / Sounds

Observer

okbirdman

Date

August 13, 2023 08:29 AM PDT

Photos / Sounds

What

Cuban Tree Frog (Osteopilus septentrionalis)

Observer

ryansikola

Date

April 22, 2019 05:44 PM PDT

Description

Walmart plant section herping

Photos / Sounds

Observer

okbirdman

Date

July 20, 2023 03:26 PM PDT

Description

Ex broadleaf forget-me-not (Myosotis latifolia)

Photos / Sounds

What

Dwarf Brittle Star (Amphipholis squamata)

Observer

damontighe

Date

May 10, 2016 07:30 PM PDT

Description

The main image is a composite I made (overlay) of the brittle star bioluminescencing in the dark and the image of the brittle star hit with a flash. I had read that Amphipholis squamata had bioluminescence but hadn't seen any images from the California coast, so I brought home a few from the docks at Jack London and took lots of photos, some 30 minutes long at my highest ISO and got nothing. I did some more reading and 200mM KCl can cause a depolarization event leading to extreme bioluminescence so I dissolved a Emergen-C vitamin fizzy drink that has potassium carbonate in it in a minimal amount of water and added that to a few isolated brittle stars and BAM! Light show!

Photos / Sounds

What

Black × Eastern Phoebe (Sayornis nigricans × phoebe)

Date

September 17, 2023

Description

4 photos

Photos / Sounds

Observer

okbirdman

Date

August 5, 2023 01:54 PM PDT

Photos / Sounds

Observer

jmorton

Date

May 6, 2008 07:46 AM PDT

Photos / Sounds

What

Dicots (Class Magnoliopsida)

Observer

okbirdman

Date

April 21, 2021 07:47 PM CDT

Photos / Sounds

What

Painted Maple Aphid (Drepanaphis acerifoliae)

Observer

okbirdman

Date

June 20, 2023 05:11 PM PDT

Description

On red maple (Acer rubrum)

Photos / Sounds

Observer

ponerinecat

Date

January 1, 2023 04:05 PM PST

Description

Undescribed, probably. Not E. armatus due to most legs being 6 segmented. Not E. washingtongensis due to the shape of b2. Not E. spinosus or E. arcuatus due to the shape of st. Not E. californicus due to the length of b3 and the shape of the anal plate. I lack literature for both E. latzeli and unciger, but I beleive both of them are eastern species?

Photos / Sounds

What

California Assiminea (Angustassiminea californica)

Observer

michaelvoeltz

Date

March 7, 2023 08:00 AM PST

Description

Several dozens observed under flat piece of waste asphalt just above wrack line, near edge of mud flats. Tons of amphipods and sea slaters alongside them. Found a number of mouse-eared snails in the mix as well.
Overview of species

Photos / Sounds

What

Winged and Once-winged Insects (Subclass Pterygota)

Observer

okbirdman

Date

June 6, 2023 11:35 AM PDT

Description

On blue gum eucalyptus leaf. Not sure if larva in an egg or trapped inside water droplet

Photos / Sounds

What

Longfin Smelt (Spirinchus thaleichthys)

Observer

catchang

Date

February 7, 2018 03:35 PM PST

Photos / Sounds

What

Shiner Surfperch (Cymatogaster aggregata)

Observer

okbirdman

Date

July 18, 2023 07:02 PM PDT

Description

Terrible pictures. ~3 cm in length, mostly staying in place among shallow algae. Overall impression (tapered head with upturned mouth, rounded caudal fin) looks most to me like Fundulidae. Markings remind me of Lucania goodei (olive above, white below with wide black lateral line, dark base of dorsal fin). I think that salinity is too high in Ballena Bay for this species, and I think this species is uncommon in its introduced region of California, but I don't have any other strong theories.

Photos / Sounds

What

Dusky Seaside Sparrow (Ammospiza maritima ssp. nigrescens)

Observer

ouzel701

Date

July 1978

Description

Singing male

Photos / Sounds

What

Yangtze Giant Softshell Turtle (Rafetus swinhoei)

Observer

astrapia

Place

Vietnam (Google, OSM)

Photos / Sounds

What

Chiriquí Harlequin Frog (Atelopus chiriquiensis)

Observer

coonassitsme

Date

July 1981

Photos / Sounds

What

Yellow-tipped Oahu Tree Snail (Achatinella apexfulva)

Observer

bholland

Date

November 2016

Place

Hawaii, US (Google, OSM)

Photos / Sounds

What

Atitlán Grebe (Podilymbus gigas)

Observer

valeriosbordoni

Place

Guatemala (Google, OSM)

Photos / Sounds

What

Northern Bobwhite (Colinus virginianus)

Observer

flapflapglide

Date

January 2010

Photos / Sounds

What

Masked Bobwhite (Colinus virginianus ssp. ridgwayi)

Observer

chwillbill68

Date

December 2017

Description

need some id help.

Photos / Sounds

Observer

kueda

Date

June 13, 2021 02:55 PM PDT

Description

Singing from Baccharis at the edge of a Stipa pulchra meadow. Second recording was at point blank range, so that might be some weird distortion.

Photos / Sounds

What

Southern Springhare (Pedetes capensis)

Observer

alexfrood

Date

August 6, 2019 05:53 PM CEST

Description

First known wild observations and discovery of natural fluorescent in an old world mammal or any mammal outside of North and Central America, images of the Springhare taken in August 2019. Incredible to see it’s orange and pink glow firsthand, especially when it wasn’t expected! Accidental discovery whilst out photographing scorpions under UV light

Shot using a Nikon D850 Handheld with a Nitecore Chameleon C6 ( 365nm ) torch.

For anyone interested in February 2020 a Scientific journal was released by a American research group ( no relation to me ) about this UV trait and science behind it from research in museum & zoo specimens in the US.

There are a few more images, but you might be able to imagine photographing a rather skittish nocturnal creature on foot with a UV torch in one hand and a large DSLR in the other during a unexpected encounter whilst also trying to expose a camera correctly for UV light isn’t the easiest thing to do the split second.

Photos / Sounds

Observer

okbirdman

Date

June 30, 2023 10:42 PM PDT

Description

On Rosa sp.

According to this observation, this is part of a known group of Diplolepis that are not quite consistent with D. polita. I will keep this at genus level until molecular work clarifies the relationship, unless it would make more sense to assign this to D. polita in order to atlas this group for subsequent taxon swaps

Photos / Sounds

Observer

isawe

Date

January 2018

Description

1000 meters altitude

Photos / Sounds

What

Schönherr's Blue Weevil (Eupholus schoenherrii)

Observer

kristofz

Date

December 24, 2017 09:48 AM EST

Description

Identification as E. schoenherri confirmed by Alexander Riedel (State Museum of Natural History Karlsruhe). The Arfak population represents subspecies petiti (see photo in www.papua-insects.nl/insect%20orders/Coleoptera/Curculionoidea/Curculionidae/Eupholus%20schoenherri%20petiti.jpg). Habitat: understory of primary montane forest at 1800 m elev.

Photos / Sounds

Date

May 27, 2023 09:45 AM EDT

Description

I highly recommend taking a look at this fascinating article on the remarkable rediscovery of Scyphacella arenicola by Dr. Pallieter De Smedt, featured on the Smithsonian's Website!

https://naturalhistory.si.edu/research/invertebrate-zoology/news-and-highlights/isopod-rediscovery

This is the second beach, out of four, with the species.

Photos / Sounds

Observer

johnsankey

Date

August 15, 2017

Description

on Sonchus arvensis, length 1.6 mm

Photos / Sounds

Observer

pogon

Date

February 20, 2021 10:23 AM PST

Description

There is a major die-off of Eucalyptus on Albany Hill. Isolating fungi from the leaf lesions yielded this culture, which is a known pathogen elsewhere. It grows as sort of a yeasty black culture.

ITS sequence: AAGGATCATTAAAGAGTAAGGGGCTAAACACCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTTGTTGCTTTGGCGGGACCGCTCGGTTCCGAGCCGCCAGGCCCCCTCACCGGGGTCGCGGCGAGTTCCCGCCAGAGTTAAACCAAACTCTTGTTATATAAACCGGTCGTCTGAGTAAAAATTTTGAATTAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATTGCTTGGTATTGGGCTCACCGTCCCCGCCAGTCGGGGGCGTGCCTCAAACACCTCGGCGGAGCCTCACCGGCTTTGGGCGTAGTAGATTTTCTAATAACGTCCTTTAACGGAGAGTGCTTCTTTGCCGATTGAAGACTTACACTTCTTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA

Photos / Sounds

What

Long Valley Pyrg (Pyrgulopsis longae)

Observer

coreyjlange

Date

August 7, 2020 07:32 AM PDT

Description

It took me some sleuthing to figure out where the actual type locality for this species was located. This species was described by Hershler (1995), and the type locality information provided was:

"Type locality: Unnamed spring about 4.8 km west-southwest of Hallelujah Junction, Long Valley, Lassen County, California, T. 22 N, R. 17 E, SW 1/4 sec. 9 (Figure 4E). Holotype, USNM 860642 (Figure 5E); paratypes, USNM 858262, collected by R. Hershler and D. Sada, 3 August 1990. Snails were commonly found on stones and in watercress of this large spring, which was situated adjacent to a residence and had been recently excavated."

"Remarks: This species is known only from the type locality in the southern end of the Honey Lake basin (Figure 6)."

The township and range described in the paper was wrong, as no springs matching the description provided were located there. However, using Google Earth I was able to identify a few possible spring candidates that could be the type locality approximately 4.8 km southwest of Hallelujah Junction. All of the springs that I thought could have been the type locality were located on private land owned by the City of Santa Clara. I obtained written permission to visit the property and quickly located the type locality spring behind the abandoned house on the property. Springsnails were not overly common in the spring, and the spring had been previously developed in the past. There was also evidence of use of the spring by cattle. I've attached two photos of the spring to this observation. I checked nearby springs to see if I could find springsnails, but I found no Pyrgulopsis in any other nearby springs.

The correct Township and Range for this spring and type locality would be: T. 22 N, R. 17 E, SE 1/4 sec. 17

https://repository.si.edu/bitstream/handle/10088/11299/iz_Hershler1995.pdf

Photos / Sounds

What

Alameda Song Sparrow (Melospiza melodia ssp. pusillula)

Observer

arnel

Date

March 31, 2018 09:19 AM PDT

Description

Alameda Salt Marsh Song Sparrow (Melospiza melodia ssp. pusillula), photographed at Alviso Marsh in Alviso Marina County Park. Identiified as such from the bird's very heavy, dark streaking and its location in one of the South Bay's salt marshes.

Alviso Marina County Park is located in the Alviso district of San Jose, CA, in northern Santa Clara County. It is an excellent place to look for Alameda Salt Marsh Song Sparrow, as well as other salt marsh specialists.

References:
1) Chan, Yvonne, and Spautz, Hildie, "Alamda Salt Marsh Song Sparrow." California Bird Species of Special Concern, 2008. Pp. 419 - 424.
2) Nur, Nadav, et. al., "Tidal Marsh Song Sparrows of San Francisco Bay," 2002. Pp. 1-4
3) Rising, James D., The Sparrows of the United States and Canada. Academic Press, 1996, pp. 190 - 195.

Photos / Sounds

What

Vesper Sparrow (Pooecetes gramineus)

Observer

okbirdman

Date

April 24, 2022 12:34 PM PDT

Photos / Sounds

Observer

shaun-lee

Date

February 21, 2016

Description

Bioluminescent Limpet

Photos / Sounds

Observer

graysquirrel

Date

March 28, 2022 03:18 PM PDT

Description

Host is Claytonia perfoliata

Photos / Sounds

Observer

patrickhoffman

Date

July 16, 2010

Description

The first photo is the cercaria stage shed from a planorbid snail collected from a pond at Pleasanton Ridge Regional Park. The second photo shows an infected Pseudacris sierra from the same pond.

Photos / Sounds

Observer

okbirdman

Date

March 21, 2022 01:15 PM PDT

Photos / Sounds

What

Common Black × Red-shouldered Hawk (Buteogallus anthracinus × Buteo lineatus)

Date

February 2022

Description

This is a Common Black Hawk x California Red-shouldered Hawk. Not sure how to get this as the ID.
Known offspring of the Common Blackhawk that lived here for 15 years.

Photos / Sounds

Observer

okbirdman

Date

April 16, 2021 12:11 PM CDT

Description

On Quercus stellata. Not positive gall wasp but best place to start

Photos / Sounds

Observer

okbirdman

Date

April 4, 2021 04:04 PM CDT

Photos / Sounds

What

Thin-spined Jumping Spider (Tutelina elegans)

Observer

tshahan

Date

June 2010

Photos / Sounds

What

California Slender Salamander (Batrachoseps attenuatus)

Observer

damontighe

Date

February 2021

Description

Leucistic? The pigment in the ocular orbitals is making me hesitate on saying albino

Photos / Sounds

What

Red-winged Blackbird (Agelaius phoeniceus)

Observer

greglasley

Date

June 1, 1989

Description

Red-winged Blackbird
near Stewardson, Illinois
1 June 1989

I'm posting this record just for the general interest of a Red-winged Blackbird with one white wing. Whether a partial albino, or a partial leucistic bird, I'm not sure. A local farmer told my wife and me that this bird had been on his farm for three summers. The bird left in the fall with the other Red-wingeds and came back in the spring. I watched it for about 30 minutes. It vocalized like any other Red-winged BB and interacted with other Red-wingeds normally. It was pretty flashy to see in flight, however. Three shots posted. These images scanned from old color slides.

Photos / Sounds

What

Fisher (Pekania pennanti)

Observer

devonted

Date

July 29, 2019 08:42 PM EDT

Photos / Sounds

Observer

okbirdman

Date

February 6, 2021 10:16 AM CST

Photos / Sounds

What

Grey Fox (Urocyon cinereoargenteus)

Observer

ribitzki49

Date

January 5, 2021 07:32 PM CST

Description

home

Photos / Sounds

What

Brown-headed Cowbird (Molothrus ater)

Observer

lwbadger

Date

June 3, 2018 12:22 PM CDT

Photos / Sounds

What

Great White Shark (Carcharodon carcharias)

Observer

sharksteward

Date

August 2020

Description

Picture Gary Emich

Photos / Sounds

Observer

simono

Date

July 1, 2018 10:54 PM AWST

Description

In the peak of the top end dry season. A mantis crashed into the spotlight of my parked vehicle and fell on the ground, stunned. The katydid immediately arrived and began eating it. This is a dried up creek bed and the nearby vegetation is extremely dry - perhaps the katydid desperately needed the moisture. Bowerbird.org.au sighting being moved to iNaturalist as the former website is shutting down.

Photos / Sounds

What

Eastern Hognose Snake (Heterodon platirhinos)

Observer

kevin193

Date

June 5, 2020 07:06 AM UTC

Photos / Sounds

What

American Kestrel (Falco sparverius)

Observer

wingnut

Date

October 26, 2018 05:51 AM EDT

Description

With mantis as prey!

Mollusks

Photos / Sounds

What

Molluscs (Phylum Mollusca)

Observer

cymbalaria

Date

July 16, 2018 08:38 AM CEST

Photos / Sounds

What

Shrews (Family Soricidae)

Observer

colin25

Date

December 12, 2020 04:38 PM SAST

Photos / Sounds

What

Tufted × Black-crested Titmouse (Baeolophus bicolor × atricristatus)

Observer

lukearmstrong

Date

November 23, 2011 09:53 AM EST

Photos / Sounds

What

Great Zebra (Graphium xenocles)

Observer

stijn_de_win

Date

April 13, 2008 05:17 AM +08

Description

At arrow

Photos / Sounds

What

Western Atlantic Temperate Basses (Genus Morone)

Observer

okbirdman

Date

September 19, 2020 04:32 PM CDT

Description

I'm pretty sure a hybrid but I'm not positive which two. I believe all four are now in this waterway. I was thinking M. chrysops x americana or M. chrysops x mississippiensis but I haven't been able to find any photos of these crosses for comparison.