Photos / Sounds

What

Psychedelic Ovoid Mushroom (Psilocybe ovoideocystidiata)

Observer

hongoman

Date

June 2, 2019 09:07 AM PDT

Photos / Sounds

Observer

alan_rockefeller

Date

November 27, 2021

Description

Growing on old horse manure.

Photos / Sounds

Observer

alan_rockefeller

Date

September 21, 2021

Photos / Sounds

Date

March 12, 2012 12:38 AM CDT

Description

Found on Volcan Chaiten a couple years after eruption growing off buried wood debris.

Photos / Sounds

Date

March 20, 2012 12:09 AM CDT

Description

Found growing off buried wood debris in lahar of eruption event which melted the glacier shown in the backgound of Michinmahuida

Photos / Sounds

What

Common Gilled Mushrooms and Allies (Order Agaricales)

Observer

aucklandgnome

Date

February 7, 2022 10:26 AM +13

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

jonnyvanbatman

Date

November 2021

Description

On dung, with removable cap cuticle.

Photos / Sounds

What

Dewdrop Mottlegill (Panaeolus acuminatus)

Observer

jonnyvanbatman

Date

December 12, 2021 12:44 PM GMT

Photos / Sounds

Observer

jonnyvanbatman

Date

December 12, 2021 12:53 PM GMT

Photos / Sounds

Observer

jonnyvanbatman

Date

December 23, 2021 11:22 AM GMT

Description

On a very humid pine forest clearing.
Evident chryrocystidia.
Spore measures:
(12.3) 13 - 14.7 (15.6) × (6.7) 7.2 - 8.5 (8.7) µm
Q = (1.6) 1.7 - 1.85 (1.9) ; N = 30
Me = 13.7 × 7.8 µm ; Qe = 1.8

Photos / Sounds

What

Wavy Cap (Psilocybe cyanescens)

Observer

jonnyvanbatman

Date

December 2021

Place

Portugal (Google, OSM)

Description

Between grasses. Near Pinus and Quercus.

Photos / Sounds

What

Wavy Cap (Psilocybe cyanescens)

Observer

jonnyvanbatman

Date

January 2022

Place

Portugal (Google, OSM)

Description

I didn't take photos of the hymenium but it was in a bigger collection of this species, in a place I usually find them on Eucalyptus wood. I uploaded this observation due to the interesting thing it is growing from, an Eucalyptus seed pod.
Other observations from the same place:
https://www.inaturalist.org/observations/105088916
https://www.inaturalist.org/observations/39334412

Photos / Sounds

What

Common Gilled Mushrooms and Allies (Order Agaricales)

Observer

jonnyvanbatman

Date

November 2021

Photos / Sounds

Observer

michel_beeckman

Date

November 27, 2021 03:45 PM CET

Photos / Sounds

Observer

alan_rockefeller

Date

October 2020

Description

Taste strongly like cucumber, and causes a slight tingling sensation on the tongue.

Photos / Sounds

Observer

alan_rockefeller

Date

October 2020

Photos / Sounds

Observer

alter_igel

Photos / Sounds

Observer

cooperj

Date

April 22, 2017 01:44 PM NZST

Description

The real E. translucidum

Photos / Sounds

Observer

reiner

Date

June 23, 2021 10:45 AM AEST

Photos / Sounds

Observer

alan_rockefeller

Date

May 15, 1980

Description

Collected in May, 1974 in deep shade.

R. Watling 10387

Photos / Sounds

Observer

sybeck

Date

April 2020

Description

Substrate of rich humus and sandy soil on river bank prone to flooding. Native sub-tropical rainforest and wet sclerophyll forest.
Growing singularly and spread out.
Largest specimen 6cm tall and 3.5cm pileus.
Prominently textured stipe.
Apparent blue bruising.
Local temp recently 16-23C

Photos / Sounds

Observer

alan_rockefeller

Date

May 18, 2008

Description

These two pictures are the same mushroom, taken seven days apart.

All micrographs except the first one are of the gill edge showing cheilocystidia, micrograph numbers 6,8,10 and 11 show the distinct bifurcate or irregularly branched cheilocystidia common in this species, I was unable to locate any pleurocystidia on the gill surface.

The long flexuous neck of the cheilocystidia, up to 12.5microns long is also visible!

Photos by Inski

Photos / Sounds

What

Liberty Cap (Psilocybe semilanceata)

Observer

cooperj

Date

May 13, 2006

Photos / Sounds

Observer

angulospora

Date

May 30, 2021 11:44 AM NZST

Place

Auckland (Google, OSM)

Photos / Sounds

Observer

pallantejm

Date

April 21, 2021 02:00 PM NZST

Description

Found growing out of a rotting log. At first, thought it was a juvenile Scarlet Pouch as many were nearby, but the tan coloring makes me suspect otherwise.

Photos / Sounds

What

Blue-Foot (Psilocybe caerulipes)

Observer

bethofthewoods

Photos / Sounds

What

Blue-Foot (Psilocybe caerulipes)

Observer

leptonia

Date

August 21, 2011

Photos / Sounds

Observer

anngoddard

Date

November 2018

Place

Oregon, US (Google, OSM)

Photos / Sounds

Observer

leptonia

Date

October 9, 2014

Description

CS 2066 (smaller fruitbodies, many) – near cervid dung

CS 2076 – not sure if conspecific, slightly larger, three fruitbodies

Photos / Sounds

Observer

cooperj

Date

May 10, 2012

Photos / Sounds

What

Magenta Rustgill (Gymnopilus dilepis)

Observer

petragloyn

Date

March 21, 2018 10:55 AM NZDT

Description

Growing on pile of wood chips.

Photos / Sounds

Observer

cooperj

Date

April 10, 2006

Photos / Sounds

Observer

cooperj

Date

April 9, 2017

Place

Wainoui (Google, OSM)

Photos / Sounds

Observer

davidwhyte

Date

June 17, 2021 12:25 PM NZST

Description

Two fb within meters of each other. Both on highly rotten wood under manuka / kanuka with celery tree present.

Think that I finally have cap hairs
Also maybe have a stem hair. Upon reflection, this stem hair isn't useful for diagnostics. Stem cystidia are what is required.

Unclamped joints, was not clamp like structures either

So not P similis - as this is clamped

Find the key full of jargon, and not easy to engage with. Think the following could be options, but would love some comment / input

Not P micorspermus as cap hairs / terminal cells are wrong
Not Pluteus readiarum either as these cap hairs are rounded
Discount P concentricus as cap looks very different
Not P hispidilacteus as cap size not 5-12mm
Not P decolarantus as cap size not 10 - 35 mm

P perroseus an option. Cap cells similar to this obs

Also I think this holds " P. perroseus has very pink gills typically with a fine dark edge .... and a distinctive stalk - fibrous rather than pruinose. (P. readiarum has a pruinose stalk)."

This obs does have a fine dark edge on the gill .The gills were water logged, and I also dropped the fb of the wood it was fruiting from damaging some. But that all said do think they are pink colored.

The stalk, have mico cross section, and did notice that the stem was more cobweb like, rather than 'normal' pluteus whatever that is.

Also similar cap cells, to this obs

Photos / Sounds

Observer

hendre17

Date

November 3, 2016

Description

Fruiting in small caespitose clusters in grass and alder mulch. Note the evanescent blue/green veil on mature specimens and the blue green reaction of the younger fruiting body cap margins.

Photos / Sounds

Date

November 17, 2020 02:33 PM PST

Description

Maybe ovoids? Stipe isn’t as tough as alenii or cyanescens. Seems to have a membranous annulus. Seems to be blueing. Purple-brown spores can be seen on caps.

Photos / Sounds

Observer

kernliam

Date

October 12, 2020 01:27 PM PDT

Description

Growing from new mulch in potted plants.

Photos / Sounds

Observer

brtdvs

Date

April 2020

Description

Growing in sedum from DLT plants

Photos / Sounds

Observer

damontighe

Date

December 2018

Photos / Sounds

Observer

dontgiveafungus

Date

May 23, 2019 05:23 AM PDT

Description

Found in garden nursery in an urban environment. They were growing out of wood chips that had been used in planting caraway thyme in nursery trays.

Photos / Sounds

Observer

hendre17

Date

November 3, 2016 05:46 AM PDT

Description

Commonly called "blue ringers" based on the blue green persistent veil on stems. Largest specimen in this caespitose cluster is a prime example. Fruiting in grass and bark mulch along a public path.

Photos / Sounds

Observer

damontighe

Date

November 2018

Description

spores = 9 x 6 μm

Photos / Sounds

Observer

damontighe

Date

December 2018

Photos / Sounds

Observer

noah_siegel

Date

November 2, 2011

Photos / Sounds

Observer

kentonkwok

Date

December 2020

Description

Same patch from hyphea movement! Only two,

Photos / Sounds

Observer

alan_rockefeller

Date

October 30, 2020

Description

Growing in a mulched garden.

Photos / Sounds

Observer

alan_rockefeller

Date

July 12, 1997

Description

This is the type collection of Psilocybe laurae.

Found in a mesophilic forest along the road from San Sebastian to El Bufo, 5 kilometers from San Sebastian.

I did not observe any pleurocystidia, however Alonso was studying the same collection next to me and he found several. He did not observe any of the long necked pleurocystidia which are depicted in the Psilocybe laurae species description.

All micrographs except the ones labeled “Spores 1000x” were stained with congo red.

In this species, both the pleurocystidia and cheilocystidia absorb much more congo red at the apex of the cystidia. Basidioles absorb congo red uniformly throughout the whole cell. Without congo red, it can be challenging to separate pleurocystidia from basidioles.

Photos / Sounds

Observer

bit

Date

January 31, 2008 03:58 PM PST

Description

RLc 130; Photos by Bryn Dentinger; used with permisison

Photos / Sounds

Observer

cooperj

Date

April 21, 2014

Description

A species with a blueing stem base recently described from New Zealand but also present in Australia.

Photos / Sounds

Observer

keelanorrock

Date

June 12, 2021 04:59 PM AEST

Photos / Sounds

Observer

suz1966

Date

May 2, 2021 02:33 AM UTC

Photos / Sounds

Observer

alan_rockefeller

Date

October 27, 2020

Description

In coastal dune grass (Ammophila sp.)

Photos / Sounds

What

Roundheads (Genus Stropharia)

Observer

pallantejm

Date

April 15, 2021 12:45 AM NZST

Photos / Sounds

Observer

grey

Date

June 20, 2020 02:49 PM NZST

Description

Growing in long grass. Caps to 25 mm across.

Photos / Sounds

Observer

myxomop

Date

May 24, 2016

Description

Substrate: in soil

Habitat: High-elevation oak cloud forest

Ecoregion: Talamanca Montane Forests (NA0167)

Collector(s): G. Mueller

Collection #: ? (saved by Dr. Greg Mueller)

Collected for the 2016 Organization for Tropical Studies “Fungi and Fungus-Like Organisms” Course

Photos / Sounds

Observer

alan_rockefeller

Date

September 6, 2017

Photos / Sounds

Observer

alan_rockefeller

Date

September 5, 2017

Description

Seen in an old sawmill that had a lot of old woody debris.

Photos / Sounds

Observer

majobermudez

Date

April 2021

Photos / Sounds

Observer

foreverfungi

Date

June 2021

Description

Growing from Southern Beech.

Photos / Sounds

Observer

foreverfungi

Date

June 2021

Photos / Sounds

Observer

javier212

Date

March 22, 2021 06:15 PM EDT

Photos / Sounds

Observer

davidwhyte

Date

May 2021

Description

Fruiting in a council garden. But appeared to be next to a native shrub-tree / council planted tree. I assumed as some were right next to the larger roots and others not far away, that they were eating the root system.

There wasn't much bark left from the council mulch and mulch hasn't been updated in a number of years. So this also points to feeding on other food sources.

Definitely secticod, but don't know if P weraroa, or a secticod presentation of another species.

Photos / Sounds

What

Psychedelic Ovoid Mushroom (Psilocybe ovoideocystidiata)

Observer

inoculatethewest

Date

May 12, 2021 09:18 AM PDT

Photos / Sounds

What

Psychedelic Ovoid Mushroom (Psilocybe ovoideocystidiata)

Observer

murphy570

Date

April 30, 2021

Place

Scranton (Google, OSM)

Description

On the banks of a river growing on flood debris.

Photos / Sounds

Observer

jaredbailey1

Date

May 10, 2021 01:21 PM NZST

Photos / Sounds

Date

April 14, 2021 02:57 PM NZST

Place

Khandallah (Google, OSM)

Photos / Sounds

Observer

masontacke

Date

April 22, 2021 03:13 PM AEST

Description

Spotted on the floor of dry sclerophyll forest about 15 meters from a dry creek bed, conditions moist but not wet.

Photos / Sounds

Observer

shane_marshall

Date

February 2020

Description

DNA sequencing in the ITS region has suggested this is or is very close to P.samuensis. More study to be done by Alan Rockefeller

Photos / Sounds

What

Common Gilled Mushrooms and Allies (Order Agaricales)

Date

April 18, 2021 02:19 PM NZST

Description

Noted as growing in autumn under my tomato plants

Photos / Sounds

Observer

pallantejm

Date

April 17, 2021 02:00 PM NZST

Photos / Sounds

What

Hairy Bell (Galerina atkinsoniana)

Observer

cooperj

Date

May 17, 2019 01:42 PM NZST

Photos / Sounds

Observer

possumsend

Date

January 13, 2021 10:25 PM NZDT

Description

On a scree slope at 1500m. Pea sized.

Photos / Sounds

Observer

swan_messiah

Date

May 2020

Photos / Sounds

Observer

beau_meister

Date

May 2018

Description

On aged Wombat scat

Photos / Sounds

Observer

beau_meister

Date

May 2018

Photos / Sounds

Observer

reiner

Date

July 10, 2020 03:33 PM AEST

Description

on wombat dung

Photos / Sounds

Observer

am_anita

Date

May 17, 2018 02:06 PM AEST

Description

An old pic, I had no idea what it was at the time and unfortunately didn't get more detailed photos

Photos / Sounds

Observer

hermannb

Date

March 2021

Photos / Sounds

What

Psilocybe Mushrooms (Genus Psilocybe)

Observer

angulospora

Date

March 20, 2021 11:08 AM +13

Description

Psilocybe_sp_ITS (502 bp)
CATTATTGAATGAACTTGACTCAGTTGTAGCTGGTCCTCTCGGGGGGCATGTGCTCGCTGTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGGACTAGTGAACGGGAGAGCTTGCTCTCCTAGAAGCTACACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGCCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTTAGTCGGCTCCCCTCAAATGTATTAGCCGGTSCCCCGCGCAGAGCCGTCTATTGGTGTGATAATT

Photos / Sounds

Observer

cooperj

Date

December 25, 2007

Description

cap 4mm to 2cm. convex, flattening, rugulose (phlebous), nearly black with an olivaceous hue and dark band around edge. Not especially hygrophanous. Stem 1.5-5.5cm x 1.5mm longitidinally striate, with white mycelia covering towards base, brown vinaceous, especially towards base. Gills black, with white speckling (Panaeolus -like), with white edge, no yellow sticky drops. Spore print black. 4-spored. Spores with germ pore 8.5-9 x 4-5um. Pellis an epithelioid hymeniderm of dark cells. No chrysocystidia. Cheilocystidia with slightly enalrged head. Clearly this is the Australian P. fimbriatus. New record for NZ. This species has been incorrectly recombined into psathyrella.

Photos / Sounds

What

Hare's Foot Inkcap (Coprinopsis lagopus)

Observer

simonnicholas

Date

January 27, 2021 07:56 AM +13

Photos / Sounds

Observer

alan_rockefeller

Date

July 6, 2019

Photos / Sounds

Observer

tannar_coolhaas

Date

April 23, 2019 09:51 AM AEST

Photos / Sounds

Observer

stevereekie1

Date

February 5, 2021 11:43 AM NZDT

Photos / Sounds

Observer

stevereekie1

Date

February 5, 2021 12:25 PM NZDT

Photos / Sounds

What

Hairy Parachute (Crinipellis scabella)

Observer

jane250

Date

January 29, 2021 11:20 AM +13

Description

Growing in a paddock grazed by cattle