mbowser's Favourites

ACCCTTTGTAGTCCTGGAACACCTCTCGAGGCAACTCGGTTTGAGGATTGCCGCTGCTGNTAAGCCGGCTTTCCTTGCGTTCCCGGTCTATGTCTTTATATACCCCATGAATGTAACTGAATGTCTTTAATGGGCCTTAGTGCCTTTAAATCAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTTCCAGCTTTTATTAGCTTGGTCAGGCTTGGATGTGGGGGTTGCGGGCTTCTCAGAAGTCGGCTCTCCTTAAATGCATTAGCGGAACCTTTGTTGACCAGCTCTGGTGTGATAATTATCTACGCCATTGCGAAGCAGCTTTAATAATGGGGTTCAGCTTCTAACCGTCCCCTTCACGGGACAACTCTCTGACATTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA

Scale bar = 10 µm

Valves are biundulate. The axial area is wide; sometimes nearly as wide as the central constriction. Differentiated from the similar Staurosira contruens var. binodis based on striae characteristics and valve size.

Reared from Dendroctonus rufipennis host. Emerged 31 May 2018. Keyed to Coeloides rufovariegatus, and sent one to LifeScanner. LifeScanner returns identification to Coeloides genus. When I enter the barcode into the BOLD ID engine, it also matches to "Coeloides" without a species-level match. Coeloides rufovariegatus is the only Coeloides species listed in the Arctos specimen database for Alaska.

DNA: BOLD-2R4: COI-5P: TTTTATATTTTTTTTTTGGTATGTGATCTGGAATATTAGGTTTATCAATAAGTTTAATTATTCGTATAGAATTAAGTATACCTGGTAGAATATTAGGAAATGATCAAATTTATAATGGAATAGTTACTACTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATATTAGGTGGATTTGGAAATTGATTAATTCCATTAATATTAGGTGCTCCGGATATAGCATTTCCTCGAATAAATAATATGAGATTTTGATTATTAATTCCTTCAATTATTTTATTATTATTAAGAAGAATTTTAAATGTTGGTGTAGGTACTGGTTGAACAATTTATCCTCCATTATCTTCATCTTTAGGACATAGGGGATTATCAGTAGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCTTCTATTATGGGTTCAATTAATTTTATTTCAACAATTTTAAATATACATTTATTTAAATTGGAATTAGATCAATTAACTTTATTGATTTGATCAGTTTTTATTACTACAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGGGCTATTACTATATTATTAACTGATCGAAATTTGAATACAACTTTTTTTGATTNTCAGGGGGGGG

Scale bar = 10 µm

E. adnata has valves that are dorsiventral and taper toward rounded rostrate ends. The dorsal margin is convex, while the ventral margin is concave. This species is distinguished from E. turgida based on its finer striae and its larger number of striae per costae.

Scale bar = 10 µm

Valves are biundulate, differentiating them from the nominate variety S. construens. Valves are small with rostrate to subcapitate ends. Differentiated from the similar Pseudostaurosira robusta by striae characteristics and valve size.

Scale bar = 10 µm

Valves are small, cruciform, and have rostrate to subcapitate ends. The central margin is inflated and curved. S. construens is differentiated from Pseudostaurosira pseudoconstruens based on its more narrow central sternum, and from Staurosirella leptostauron based on its narrower striae.

Scale bar = 10 µm

The shape of S. grunowii valves is dinstinctive, with concave margins, but valves that otherwise reflect the characteristics of S. linearis. This species is often cited in the literature as S. linearis var. constricta.

Scale bar = 10 µm

E. turgida valves are dorsiventral and taper toward rostrate ends, and are relatively large for the genus. E. turgida has coarser striae than E. adnata, as well as fewer striae per costae.

Scale bar = 10 µm

Valves are concentrically undulate and large, and are convex or concave. Aereolae are arranged in radiating striae, separated by hyaline costae. S. reimeri is similar, but is smaller, with a lower areolae density.