A beautiful, lignicolous, primarily tropical and subtropical genus in the Cortinariaceae. An unnamed section (as of the 4th edition of Agaricales in Modern Taxonomy) contains the (then two) species with prominent lilac pigments, though more have been described since.
Substrate: on downed, well-decomposed, decorticate “Laurel” log (Ocotea sp.)
Habitat: secondary lowland tropical rainforest, regularly subject to landslides and some human disturbance. adjacent to golf course and horse pasture.
Ecoregion: Southwest Amazon Moist Forests (NT0166)
Collectors: D. Newman, P. Kaishian, D. Ettlinger & T. Padilla
Collection #: CHOC032
Seen sitting on the ground during a snow storm
Mixed hardwood/conifer forest in the Madeline Sone Wildlife Preserve
Growing on a ~2in diameter Umbellularia californica branch in a Sequoia sempervirens and Umbellularia californica dominant forest by creek
Reflexed body form with a dark brown/black cap and margin. Hymenophore dingy, off-white to grey with irregular, angular pores
Smells like an auto mechanic shop- hints of petrochemicals and slightly metallic
KOH indistinct
White popcorn-like blobs and orange slime on Paspalum urvillei.
Grass: https://www.inaturalist.org/observations/164915845
Epicoccum andropogonis parasite (black brain-like sporodochia) https://www.inaturalist.org/observations/164916139
Fusarium: https://www.inaturalist.org/observations/171515706
Mid-day sighting wit balmy, muggy weather.
What a treat! Around a dozen of them feeding in the exposed rocky/grassy area -- and all around my friend and I :)
KOH reaction went from green to bright yellow within a few minutes. Rusty brown spores evident where gills attach to stipe (not shown as clearly in photograph). Was found growing in mixed tanoak/madrone/conifer forest.
Infrequent but not rare in mid-elevation (5-6.5 K feet) areas east and slightly northeast of Mt. Shasta.
San Vicente Redwoods- Mixed hardwood/conifer forest that burned in the 2020 CZU fire
Growing from a burned piece of wood under Quercus agrifolia, Arbutus menziesii and Pseudotsuga menziesii. Found on the side of the forest that burned at low intensity in the 2020 CZU due to cultural fire
Small cups with an olive green-brown hymenophore and a light brown exciple
Smell indistinct
A minimum of ~294 caps present in an area of ~ 3 m²
Growing in pine and fir forest. Pileus silvery, irregularly ruffled at the edges. Lamellae cinnamon brown, free. Stipe white, cylindrical with slightly bulbous base.
M000003
I think it’s Madrone. Land Trust of Santa Cruz County permit
Under Doug Fir and White fir, near creek, in burned area
This was a super cool find after work on my short xc ski trip!
I first noticed it when it either jumped down or fell from a tree. At first I thought it was a cat it was quite chonky. haha. I don't believe it saw me from the distance, though, as it appeared to be looking away (third pic). And when I retraced my tracks I stopped at where it had been approaching my tracks. At that point, I was about 20 feet away and it popped up and stared at me for 5-7 seconds. Super cute! Unfortunately I couldn't get my camera out in time again as I was struggling to get up a short and steep incline (and needed my ski poles).
What's going on with the abdomen? Oviposition?
I watched this ermine catch 5 pika on trips up and down the slopes of Cracked Crag. Chipmunk-sized with a short tail (there are no perspective tricks going on in this picture, but if needed, I can upload others with a more side-on perspective. Pika observation recorded separately here: https://www.inaturalist.org/observations/14002186
No idea what these were. They were quite large, though.
Mixed hardwood/conifer forest in the Madeline Sone Wildlife Preserve
Growing on cut woody Toxicodendron diversilobum vine which was lying on the ground under a canopy of Quercus agrifolia
Tiny, black lumps growing on the exterior of vine, about 25% displaying a vertical, rectangular ascomata resembling compressed layers of carbon
HAY-F-006457
p6 3-6
Not sure on this ID?
Phlegmacium indicum npm. prov.
Mixed hardwood/conifer forest in the Madeline Sone Wildlife Preserve
Growing on a dead Ilex aquifolium leaf under a young Ilex aquifolium in a forest transition ecotone between Sequoia sempervirens and Umbellularia californica dominant to deciduous Quercus dominant
Globular, irregular black dots on surface of leaf. Some seem to be "outlined" with a white ring
fruiting on road cut beneath Quercus agrifolia.
Helvella dryophilla and Peziza also emerging from the same hill side. Most of the specimens I found looked like they had already been partially eaten by some animal
flesh was lavendar in direct sunlight
no obvious scent to me but every specimen on this hill side had been eaten and within 5 minutes of it being in my office the grain moths were swarming it so it must be producing some sort of attractant the mammalian or just my nose can't detect
Microscopy:
irregular asci - ~120 um x 25 um
round spores - 12-13 um with thick wall
FDS-CA-02390
Cortinarius, Laguna Mountain Falls Trail.
Bohemia Ecological Preserve- mixed hardwood/conifer forest with scattered grasslands on serpentine vein, adjacent to Duvoul Creek
Found under Arctostaphylos bakeri, buried amongst duff on the edge of grassland
Sporangia resembling little white tufts on extremely thin, black, hair-like stalks extending in all directions from decomposing Arctostaphylos bakeri flowers
Manzanita
Cap KOH-
Faint purple tones at apex of stipe.
On interior surface of bark from well-decayed alder log under unidentifiable rotting agaric, maybe a Clitocybe? Long fibers along the entire length of stipe, shorter fibers on cap appearing powdery silver, easily brushed away revealing smooth dark cap. Gills with blue UV fluorescence
Mixed hardwood/conifer coastal forest, private property in Gualala
Growing in Pseudotsuga menziesii duff in a stand of young Pseudotsuga menziesii
Pileus peachy to flesh colored, smooth, umbilicate. Lamellae white, broadly attached. Stipe short, equal with thick white rhizomorphs
Smell slightly sweet
Taste farinaceous
KOH mild yellow on cap
anthracinus sensu CA
Under mixed hardwoods.
No color change with KOH.
On a mossy embankment in a cloud forest at 1800 meters elevation, under Quercus and Liquidambar.
This marten was likely up at 10,900ft/3300m to hunt pikas, but when I stumbled along it became very curious about me. I was able to snap photos for about 8 minutes, then moved on to photograph the flock of rosy finches that was half dosing off while observing the marten. I wasn't able to observe any predation, but may have heard a couple distant screams.
Agave deserti
Willow and alder around
Growing under Chamise in a shallow depression in the soil; mostly Chamise, but there were 2 Pinus sabiniana nearby (closest was about 15'-20' away); no detectable odor; did not taste; KOH rxn negative; observed with @panayotova; this was our second season observing this species in the same exact location (See https://www.inaturalist.org/observations/147170328 for DNA sequenced collection.)
likely "Luteodiscus hemiamyloideus" Baral nom. prov.
Not much scent, at most faint fruit.
spores ~ 9-10 x 5-6 μm
KOH yellow. UV fluorescence on base of stipe (faint green) and bright orange where KOH.
stipe tapered, no bulb
trees in proximity - Pseudotsuga menziesii, Quercus kelloggii
Under Tanoak, Madrone, Doug-Fir, White Fir, Ponderosa Pine. Along creek bank just uphill from sand mt blvd
Leucistic? The pigment in the ocular orbitals is making me hesitate on saying albino
Large, densely cespitose groups in planter with tomatoes and rosemary, appearing after tropical storm. Downy/fuzzy universal veil tissue dense on cap, extending down the stipe, also present on annulus which is weak and falls away easily. Veil tissue very soft to touch, becoming sleek on cap with desiccation. Stipe bases enmeshed in stringy mat of plant roots (both rosemary and tomato.) Strong fungal smell, rotting fruitbodies were attracting flies. Very mild taste, almost flavorless. No UV fluorescence. Even the fresher fruitbodies are weak and floppy, falling over easily without plant/planter wall/other fruitbodies to lean on. Rotten fruitbodies very strong smell, turning black/brown.
Last photo is out of focus, but it shows the thick-edged, forking gills well.
F000278
Very viscid
Largest cap I saw was maybe 1cm
Fruiting in small cluster (5 fruiting bodies) hypogeously near decayed branch. Pinus contorta and Abies magnifica/concolor nearby. Interesting odor, which took some time to develop. It smells like a mixture of leather, feet, and something akin to roasted coffee.
Tricholoma? Pale yellow throughout with some brown discolorations on the cap and gills. Growing under Manzanita with oak nearby
Growing under Quercus agrifolia; KOH rxn last 2 images of the photo set
This is the ITS1/2 for Cortinarius thiersii AAGGATCATTATTGAAATAAACCTGATGGGTTGCTGCTGGCTCTCTAGGGAGCATGTGCACACTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGATCTGGATATCTTTCTGAATGCCTGGCATTCGGGTTTGAGGATTGACTTTTGTCTTTCCTTACATTTCCAGGCCTATGTTTTCTTCATATACACCATTTATGTTATAGAATGTAATGAAAAGGGCCTTTGTGCCTACAAACCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCCTCAGGTTTTAACTTGTCGAGTGTTTGGATGTGGGGGTCTTTTGCTGGTCTCTTTTGAGGTCGGCTCCCCTAAAATGCATTAGCGGAACAATTTGTTGACCCGTTCATTGGTGTGATAACTATCTACGCTTTTGACGTGAAACAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAAATTTT
Fruiting out of brushtailed possum carcasses
In Bay, Madrone, Tanoak duff. Spores roughly 7 x 5
Found by my friend @graysquirrel
Photo and collection by Heidi Hoelting. Distanct gills, very small. I'm looking for a better photo.
On bare soil at base of chamise.
Wet trailcut soil with Ceanothus, toyon, chamise. Felty grey fibrous cap with depress in center, deeply decurrent gills. Similar to https://www.inaturalist.org/observations/198874667 collected earlier in the same month at the same location, which was much larger and more upright, unclear if the same.